Home >Documents >Sps orchid siap!!!

Sps orchid siap!!!

Date post:02-Jul-2015
Category:
View:150 times
Download:0 times
Share this document with a friend
Transcript:
  • 1. Seminar Pra SkripsiOleh : Imanuelle Orchidea (3325 10 2413)

2. INTRO (Pendahuluan) Latar Belakang; Identifikasi Masalah; Pembatasan Masalah; Perumusan Masalah; Tujuan Penelitian; Manfaat Penelitian 3. Latar Belakang 4. Genom S.typhi 5. Identifikasi Masalah Bagaimana mengisolasi gen HSP 70 berukuran 1,9 kilobasa dari bakteri Salmonella enterica serovar typhi ? Bagaimana mengamplifikasi gen HSP 70 berukuran 1,9 kilobasa dari bakteri Salmonella enterica serovar typhi ? Bagaimana mengkarakterisasi hasil amplifikasi gen HSP 70 berukuran 1,9 kilobasa dari bakteri Salmonella enterica serovar typhi ? Bagaimana menentukan urutan nukleotida hasil amplifikasi gen HSP 70 berukuran 1,9 kilobasa dari bakteri Salmonella enterica serovar typhi ? Apakah gen HSP 70 Salmonella enterica serovar typhi memiliki homologi dengan gen HSP 70 bakteri lain? 6. Pembatasan dan Perumusan Masalah Pembatasan Masalah : Isolasi, amplifikasi, ,dan sekuensing gen HSP 70 S.typhi berukuran 1,9 kilobasa. Perumusan Masalah : Bagaimana mengisolasi, mengamplifikasi, mengkarakterisasi, dan menentukan urutan nukleotida gen HSP 70 berukuran 1,9 kilobasa dari bakteri S.typhi ? 7. Tujuan dan Manfaat Penelitian Tujuan Penelitian Memperoleh DNA S.typhi, amplikon, hasil karakterisasi dan urutan nukleotida gen HSP 70 berukuran 1,9 kilobasa dari bakteri S.typhi. Manfaat Penelitian Studi awal untuk mengembangkan vaksin demam tifoid menggunakan gen HSP 70 S.typhi 8. KAJIAN TEORI 9. Gejala : demam, pusing, lemah, sakit kepala, hilangnya nafsu makan, dehidrasi, diare, dan terkadang disertai dengan muntah-muntah. Masa inkubasi : 1 minggu Lama penyakit : 6 minggu 10. Kingdom Filum Kelas Ordo Famili Genus Spesies Serotipe: Bacteria : Proteobacteria : Gamma Proteobacteria : Enterobacteriales : Enterobacteriaceae : Salmonella : Salmonella enterica : typhi 11. Salmonella enterica serovar typhi 1-3,5 m x 0,5-0,8 m besar koloni rata-rata 2-4 mm Fakultatif anaerob/aerob 12. Hasil Akhir Proses Fagositosis (1) Degradasi sebagian besar atau seluruh partikel asing atau mikroorganisme. (2) Partikel atau mikroorganisme yang resisten terhadap degradasi akan ikut beredar berkendaraan fagosit yang melahapnya. (3) Tetap tinggal dalam sitoplasma tanpa merugikan atau membunuh fagosit. 13. Protein : komponen utama metabolisme sel STRESS mengganggu sintesis protein RESPON STRESS Heat Shock Proteinsize Heat Shock Protein diklasifikasikan berdasarkan molekulnya Chaperone [HSP 70 (DnaK), HSP 40 (DnaJ), dan GrpE) : membantu pelipatan protein yang baru disintesis ke bentuk matur, membantu transpor protein melalui membran, membantu pelipatan kembali protein yang terdenaturasi. Chaperonin [HSP 60 (GroEL), HSP 10 (GroES) : berperan pada protein yang misfolding. HSP 70 dan HSP 60 bekerja sama sebagai pemandu dalam pelipatan protein Ditemukan di sitosol, dan mitokondria 14. HSP 70 S.typhi HSP 70 dikode oleh gen HSP 70 (dnaK). 15. Genom S.typhi 16. Gen HSP 70 Nama sistematik Nama gen GeneID Tipe gen Lokasi: STY0012 : dnaK : 1246523 : protein coding gene : kromosom S.typhi 11594-13510 lokus STY0012 Massa Molekul : 69,231.03------638 aa Minute/Centisome (%): 0.24 Produk : protein DnaK (HSP 70) 17. ATGGGTAAAA TTATTGGTAT CGACCTGGGT ACTACCAACT CTTGTGTAG C GATTATGGAT GGAACGCAGG CACGCGTGCT GGAGAACGCC GAGGGCGATC GCACTAC GCC TTCTATCATT GCTTATACCC AGGATGGTGA AACTCTGGTT GGTCAGCCGG CTAAACGTC A GGCAGTGACA AACCCGCAAA ACACCCTGTT TGCGATTAAA CGCCTGATTG GCCGCCGCT T CCAGGACGAA GAAGTTCAAC GTGACGTTTC TATCATGCCG TACAAAATCA TCGGCGCCG A CAACGGCGAC GCATGGCTTG ATGTGAAAGG TCAGAAAATG GCGCCGCCGC AGATTTCT GC CGAAGTGCTG AAGAAAATGA AGAAAACGGC TGAAGATTAT CTGGGCGAAC CGGTAACT GA AGCGGTTATC ACCGTACCGG CTTACTTTAA CGATGCGCAG CGTCAGGCTA CCAAAGATG C TGGTCGTATC GCGGGGCTGG AAGTTAAACG TATCATCAAC GAACCGACTG CCGCAGCG CT GGCTTACGGT CTGGATAAAG AAGTCGGCAA CCGTACTATC GCGGTTTACG ACCTCGGTG G TGGTACTTTC GATATCTCTA TTATCGAAAT CGACGAAGTT GATGGCGAAA AAACCTTTG A AGTTCTGGCA ACCAACGGTG ATACCCACCT GGGTGGTGAA GACTTCGATA CCCGCCTGA T CAACTACCTC GTTGACGAGT TTAAGAAAGA TCAGGGCATC GACCTGCGTA ACGATCCG CT GGCCATGCAG CGCCTGAAAG AAGCCGCAGA AAAAGCCAAA ATCGAGCTGT CTTCTGCG CA GCAGACCGAC GTGAACCTGC CGTACATTAC CGCAGATGCC ACCGGTCCGA AACACATGA A CATCAAAGTG ACCCGTGCGA AACTGGAAAG CCTGGTTGAA GATCTGGTGA ACCGTTCT AT CGAGCCGCTGAAAGTCGCAC TGCAGGACGC TGGCCTGTCC GTGTCTGATA TCAACGACG T GATCCTCGTC GGCGGTCAGA CCCGTATGCC AATGGTGCAG AAAAAAGTGG CTGAGTTC TT CGGTAAAGAG CCGCGTAAAG ACGTTAACCC GGACGAAGCT GTGGCTATCG GCGCAGCG GT ACAGGGCGGC GTATTGACCG GTGATGTGAA AGACGTACTG CTGCTGGACG TTACCCCGC T GTCTCTGGGT ATCGAAACGA TGGGTGGCGT GATGACTCCG CTTATCACCA AAAACACCA C CATCCCGACC AAGCACAGCC AGGTGTTCTC TACTGCGGAA GACAACCAGT CTGCGGTA AC CATCCATGTG CTGCAGGGTG AGCGTAAACG TGCGTCTGAT AACAAATCTC TGGGTCAG TT CAACCTGGAT GGCATCAACC CGGCGCCGCG CGGTATGCCG CAGATCGAAG TCACCTTC GA TATCGATGCT GACGGTATCC TGCACGTCTC CGCGAAAGAT AAAAATAGCG GTAAAGAG CA GAAGATCACT ATCAAGGCGT CTTCTGGTCT GAACGAGGAA GAAATTCAGA AAATGGTTC G CGATGCAGAA GCGAACGCTG AATCCGACCG TAAGTTCGAA GAGCTGGTTC AGACCCGT AA CCAGGGTGAC CATCTGCTGC ACAGCACCCG TAAGCAGGTT GAAGAAGCAG GCGATAAA CT GCCGGCTGAT GACAAAACCG CTATCGAGTC TGCGCTGAGC GCGCTGGAAA CTGCCCTG AA AGGCGAAGAT AAAGCCGCTA TCGAAGCGAA AATGCAGGAG CTGGCGCAGG TTTCCCAG AA ACTGATGGAA ATCGCTCAGC AGCAACATGC GCAGCAGCAG GCTGGCTCCG CCGACGCT TC TGCAAACAAT GCGAAAGATG ACGACGTTGT CGACGCTGAG TTTGAAGAAG TAAAAGAT AA AAAATAA 18. Perusakkan dan pembuangan dinding sel, Lisis sel Pembuangan debris sel, serta Pemisahan DNA dari protein dan RNA. 19. Polymerase Chain Reaction (PCR) 20. Primer Primer HSP 70 F : 5-GGA TCC GGT AAA ATT ATT GGT ATC GAC-3. Primer HSP 70 R : 5-AAG CTT TTA TCT TTT ACT TCT TCA AAC TC-3. 21. Karakterisasi Hasil Isolasi dan Produk PCR Menggunakan elektroforesis gel agarosa 22. Tujuan Operasional Memperoleh biakan bakteri Salmonella enterica serovar typhi dalam medium padat dan cair Memperoleh DNA Salmonella enterica serovar typhi Memperoleh amplikon gen HSP 70 S.typhi dengan Polymerase Chain Reaction Mendapatkan hasil karakterisasi gen HSP 70 S.typhi menggunakan elektroforesis gel agarosa Memperoleh gen HSP 70 S.typhi terpurifikasi dan urutan nukleotida gen HSP 70 S.typhi berukuran 1,9 kilobasa 23. Tempat dan Waktu Penelitian Tempat : Laboratorium Biokimia-Bioteknologi FMIPA UNJ . dan Laboratorium Mikrobiologi FMIPA UNJ, Waktu : Desember 2013-Maret 2014. 24. Metode : EKSPLORATIF 25. INSTRUMENTASI PENELITIAN 26. Peralatan dan Bahan yang Dibutuhkan Pembiakkan bakteri : petri dish, pipet serologi, gelas kimia, tabung reaksi,labu erlenmeyer, tabung reaksi, hot plate stirrer, jarum ose steril, pembakar bunsen, autoklaf, orbital shaker, dan laminar airflow. akuades , medium Salmonella-Shigella Agar dan Nutrient Broth Pembuatan glycerol stock: Pipet serologi, pipet mikro, tabung ependorf steril Glycerol, overnight culture S.typhi 27. Peralatan dan Bahan yang Dibutuhkan Isolasi genom S.typhi tabung mikro 1.5 mL, Pipet mikro dengan tip steril, berukuran 0.5-10 L, 20-200 L, dan 100-1000 L, mikrosentrifuse, vortex, water bath 37oC dan 80oC, laminar airflow, dan lemari pendingin Overnight culture S.typhi , kit Wizard (Promega), etanol 70%, dan isopropanol. Amplifikasi Gen HSP 70 S.typhi tabung mikro steril 100 L, pipet mikro 0.2-20 L dengan tip steril, thermal cycler, lemari pendingin. genom bakteri, kit PCR, dan primer. 28. Peralatan dan Bahan yang Dibutuhkan Karakterisasi dan Purifikasi Produk PCR kit elektroforesis gel agarosa, kit purifikasi, pipet mikro 0.2-20 L dengan tip steril, UV transluminator, dan alat dokumentasi. produk PCR, DNA Ladder (Promega), Loading Dye 6x (Promega), buffer Tris Asetat EDTA 1x (Promega), gel agarosa 2 % (1 gram agarosa dan 50 mL buffer TAE 1x), etidium bromide 0.1% (Promega ) 29. PROSEDUR PENELITIAN 30. 1. Pembiakkan bakteri S.typhi pada medium padat dan cair 2. Pembuatan glycerol stock bakteri S.typhi 3. Isolasi genom bakteri S.typhi dengan kit Wizard dan Karakterisasinya 4. Penyiapan primer gen HSP 70 5. Amplifikasi gen HSP 70 berukuran 1,9 kilobasa 6. Karakterisasi hasil amplifikasi gen HSP 70 berukuran 1,9 kilobasa dengan elektroforesis gel agarosa 7. Purifikasi hasil amplifikasi gen HSP 70 dengan kit 8. Sekuensing dengan metode dideoxy Sanger 31. Pembiakkan S.typhi pada Medium Padat Sterilisasi peralatan gelas (petri dish, erlenmeyer, pipet,dll)Petri dish steril Membuat medium agar, dituangkan ke dalam petri dish, dibiarkan mengerasBiakan S.typhi pada agar miringDiambil dengan jarum ose sterilDigoreskan secara zig-zag pada medium agar steril Inkubasi selama 16-18 jam pada 37oCdilakukan dalam laminar airflow 32. Pembiakan S.typhi pada Medium Cair dan Pembuatan Glycerol Stock Biakan S.typhi pada SS Agar Diambil dengan jarum ose steril800 L Overnight culture bakteri S.typhi dalam medium cair +Dicelupkan ke dalam 5 ml Medium cair Nutrien Broth steril200 L filter-sterilized glycerolInkubasi selama 16-18 jam pada 37oC dengan aerasi shaker 150 rpmDimasukkan ke tabung eppendorf 1 mlOvernight culture bakteri S.typhi dalam medium cairDihomogenkan lalu Disimpan pada suhu -80oC 33. Isolasi genom bakteri S.typhi dengan kit Wizard dan karakterisasinya 1 ml Overnight culture S.typhi tabung mikrosentrifuse eppendorf steril 1,5 ml Sentrifugasi 2 menit pada 13,000-16,000 g Pellet selSupernatan+ 600 L Nuclei Lysis SolutionBeaker glass berisi desinfektanDihomogenkan dengan pemipetan naik turun 34. Setelah homogen Diinkubasi pada 80oC Didinginkan +3 L RNase Solution Tabung ditutup, dibolak-balikkan 2-5x Diinkubasi pada 37oC selama 15-60 menit Didinginkan kembali pada suhu kamar +200 L Protein Precipitation Solution Divortex 20 detik Diinkubasi 5 menit dalam es Sentrifugasi 3 menit pada 13,000-16,000 gSupernatanPellet sel/ residu protein 35. SupernatanTabung eppendorf steril berisi isopropanol pada suhu kamar Dibolak-balik hingga benang-benang DNA nampak Sentrifugasi 2 menit pada 13,000-16,000 g Pellet DNA Dicuci dengan 600 L etanol 70% Tabung ditutup,

Click here to load reader

Embed Size (px)
Recommended